DNA methyltransferase - PDFSEARCH.IO - Document Search Engine

DNA methyltransferase
Results: 137

#	Item
31	6 Biological Science PF Activity Report 2008 #26 Recognition of Hemi-Methylated DNA by the SRA Protein UHRF1 Using a Base-Flipping Mechanism Add to Reading List Source URL: pfwww.kek.jp Language: English - Date: 2010-02-04 02:10:01 Molecular genetics DNA DNA methyltransferase DNA methylation Methylation Chromatin Methyltransferase CpG site Cytosine Biology Genetics Epigenetics
32	category primer sequence SSLP markers zC250L3F GGGTTTGTGAATGGAATGATG zC250L3R AGCGTCCACTGCTCAGAATC zC74M13F CCTCCTCCCAAAAACACATC Add to Reading List Source URL: jhoonline.org Language: English Chemistry Polymerase chain reaction Laboratory techniques DNA methyltransferase Biotechnology DNMT1 Real-time polymerase chain reaction Primer Biology Molecular biology Biochemistry
33	Targeted analysis of nucleotide and copy number variation by exon capture in allotetraploid wheat genome Add to Reading List Source URL: www.genomebiology.com Language: English Gene expression DNA Molecular biology Posttranslational modification DNA methylation Methylation Regulation of gene expression Bisulfite sequencing DNA methyltransferase Biology Genetics Epigenetics
34	Age-associated DNA methylation changes in immune genes, histone modifiers and chromatin remodeling factors within 5Łyears after birth in human blood leukocytes Add to Reading List Source URL: www.clinicalepigeneticsjournal.com Language: English DNA Molecular genetics Posttranslational modification DNA methylation Genomics CpG site Methylation CpG island DNA methyltransferase Genetics Biology Epigenetics
35	Journal of Translational Medicine This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. miR-148b reverses cisplatin Add to Reading List Source URL: www.translational-medicine.com Language: English Chemistry A549 cell DNA methyltransferase A549 Cisplatin Mir-200 Non-small-cell lung carcinoma Epigenetics Genetics MicroRNA Biology
36	Epigenetics and developmental plasticity across species Add to Reading List Source URL: champagnelab.psych.columbia.edu Language: English - Date: 2013-08-13 12:12:14 Methylation DNA methylation Cellular differentiation Genomic imprinting Reprogramming DNA methyltransferase Epigenome Heredity Lamarckism Genetics Biology Epigenetics
37	Leveraging the Flexibility of Multi-color Imaging of Extremely Long SingleMolecules in NanoChannels for Epigenetic Profile Mapping, Centromere Probing by Hybridization and Sample Multiplexing Authors: A. Hastie1, DH. Zha Add to Reading List Source URL: www.bionanogenomics.com Language: English - Date: 2015-03-03 13:35:55 Molecular biology Genomics DNA Bisulfite sequencing DNA methyltransferase Methylation CpG site Sequencing Centromere Biology Genetics Epigenetics
38	American Brain Tumor Association Webinar Molecular Testing: how it is used to guide treatment decisions >> The American brain tumor Association is pleased to welcome you back to our webinar series. Our webinar today will Add to Reading List Source URL: www.abta.org Language: English - Date: 2015-02-19 17:06:17 Glioblastoma multiforme Temozolomide Glioma O-6-methylguanine-DNA methyltransferase Melanoma Cancer Breast cancer Oligodendroglioma Somatic evolution in cancer Medicine Brain tumor Oncology
39	Gravina et al. Molecular Cancer 2010, 9:305 http://www.molecular-cancer.com/contentREVIEW Open Access Add to Reading List Source URL: www.molecular-cancer.com Language: English Programmed cell death Epigenetics Apoptosis Cellular processes Carcinogenesis DNA methyltransferase DNA methylation Poly ADP ribose polymerase DNA repair Biology Medicine Genetics
40	Lysine methyltransferase G9a is not required for DNMT3A/3B anchoring to methylated nucleosomes and maintenance of DNA methylation in somatic cells Add to Reading List Source URL: www.epigeneticsandchromatin.com Language: English Hypersensitive site Chip-sequencing DNase-Seq Enhancer Retina Promoter Gene Transcription factor Neural development Biology Biochemistry Gene expression

UPDATE